Takween. Sciences de la vie, Biochimie
Life Sciences, Biochemistry
علوم الحياة، بيوكيمياء
Cours -- TD -- TP
Transition Secondaire-Supérieur
إنتقال ثانوي - عالي

Acides nucléiques (DNA, RNA). Contrôles (examens)


Recherche rapide dans ce site et les sites liés de l'auteur (Fr, Ar, Eng) - بحث سريع في هذا الموقع و المواقع المرتبطة للمؤلف:


ADN, ARN

LIENS UTILES

- Nucléotides à DNA et RNA
- Acides nucléiques. Structure 3D
- QCM Nucléosides & Nucléotides
- QCM Acides nucléiques (ADN, ARN)
- ADN (DNA), ARN (RNA). QCM
- Biologie moléculaire. Examen TP S4
- Purification, analyse DNA du plasmide. Contrôle TP 2015


NOUVEAU LIVRE

-Livre 'Structures et Métabolisme des Sucres', Baaziz, 2018(+ DVD, 400 QCM):
Sciences et vie, Biochimie
-> Présentation du livre
-> Afiche annonce du livre
Partager cette information sur les réseaux sociaux تبادل المعلومة عبر المواقع الإجتماعية
facebook google plus Twitter Linkedin

PREPARATION AUX EXAMENS ET CONTROLES


Les acides nucléiques sont représentés par l'ADN (DNA) et l'ARN (RNA). Ils sont constitués de nucléotides différents par les bases azotées pour le même type d'acides nucléiques et par les bases azotées et le pentose entre ADN et ARN


Sur cette même page: Acides nucléiques, contrôle 1
- Acides nucléiques, contrôle 2

Contrôle du module 'Biochimie structurale, partie acides nucléiques -- Réponses brèves


Réponses brèves -- Revenir au contrôle 2012
Avertissement: Les éléments d'information ci joints ne peuvent constituer les réponses complètes aux questions posées, considérant d'éventuels manques de précisions que le responsable de l'épreuve pourrait fournir suite à la demande des étudiants.

Question 1 .....

Question 2. L'ADN X est constitué d'une répétition d'un fragment de 30 pb comme le montre le profil électrophorétique de l'hdrolysat (hydrolyse totale).

Question 3. Une seule séquence de 30 pb qui se répète une fois, 2 fois, 3 fois, ... ou 7 fois) ....


Contrôle 1 du module 'Biochimie structurale, partie acides nucléiques, ---- Réponses brèves


Le DNA L a été isolé par ultracentrifugation isopycnique. L'étude de la variation de l'absorbance à 260 nm est menée en fonction de la température (entre 20°C et 100°C). Cette étude fait apparaître une augmentation brutale de l'absorbance suivie d'une stabilisation.


Question 7: Que représente l'augmentation de l'absorbance ?. Cette augmentation révèle-t-elle une modification structurale du DNA ? Laquelle ?

Question 8: Connaissant la Tm du poly-dAT (63,3°C) et du poly-dGC (110°C), pouvez- vous prédire (déterminer) la Tm du DNA L ?. Justifier votre réponse.

Question 9: Que représente la valeur Tm du DNA L au niveau structural ?

Question 10: A partir des résultats obtenus, serait-il possible de déterminer la densité en g/cm3 du DNA L ?. Justifier votre réponse.

Question 11: Le DNA X et le DNA L sont dénaturés séparément et renaturés par chauffage puis refroidissement lent. Lequel des deux DNA reformera le plus souvent la molécule d'origine ?. Justifiez votre réponse.


Réponses brèves -- Revenir au contrôle 2008


Avertissement: Les éléments d'information ci joints ne peuvent constituer les réponses complètes aux questions posées, considérant d'éventuels manques de précisions que le responsable de l'épreuve pourrait fournir suite à la demande des étudiants.

Question 1: Les bandes visibles sur l'autoradiogramme représentent l'emplacement des fragments d'ADN complémentaires à l'ADN matrice et synthétisés par la DNA polymérase en présence de quatre désoxyribonucléotides (dATP, dCTP, dGTP, dTTP) auxquels sont ajoutés de faibles concentrations de l'un des quatre didésoxyribonucléotides (ddATP, ddCTP, ddGTP ou ddTTP). Le marquage radioactif (32P) porte sur le phosphore de l'amorce

Le principe du séquençage de l'ADN par la méthode de Sanger, consiste à initier la polymérisation de l’ADN à l'aide d'un petit oligonucléotide (amorce) complémentaire à une partie du fragment d’ADN à séquence (matrice)r. L’élongation de l’amorce est réalisée par le fragment de Klenow (une ADN polymérase I dépourvue d’activité exonucléase 5’->3’) ou une ADN polymérase thermostable utilisée pour la PCR. Les quatre désoxyribonucléotides (dATP, dCTP, dGTP, dTTP) sont ajoutés, ainsi qu’une faible concentration de l'un des quatre didésoxyribonucléotides (ddATP, ddCTP, ddGTP ou ddTTP)

Question 2: La différence entre le ddATP et le dATP se situe au niveau d'un manque de OH sur le carbone 3' du désoxyribose du ddATP ('faux nucléotide' non reconnu par la DNA polymérase, la polymérisation s'arrête dès qh'elle bute contre le didésoxyribonucléotide).

Question 3: Dans la réaction contenant du ddATP, les points communs (identiques) entre les différents produits de la réaction sont le port d'une extrémité à ddATP non reconnu par la DNA polymérase.

Question 4: Les points communs entre l'ensemble des produits obtenus au niveau des quatre réactions, mise à part la complémentarité avec le brin matrice, sont: 1/ la terminaison des fragments d'ADN synthétisé par l'un des quatre didésoxyribonucléotides (ddATP, ddCTP, ddGTP ou ddTTP), 2/ Tous les produitd sont prteurs de la radioactivité 32P.

Question 5: La séquence nucléotidique du brin matrice correspondant au DNA X est:

- Séquence néosynthétiséé: lecture du bas du gel (extrémité 5') vers le haut (extrémité 3'): 5'TAGCGATGCTTCAATGCTATCCGTCAGCC3'

- Séquence recherchée: 3'ATCGCTACGAAGTTACGATAGGCAGTCGG5'

soit: 5' GGCTGACGGATAGCATTGAAGCATCGCTA3'

Question 6: Pourcentage en G + C du DNA X: 51,7%

Question 7: L'augmentation de l'absorbance à 260 nm en présence du chaffage représente l'effet hyperchrome ou hyperchromicité et correspond à la dénaturation de l'ADN par altération de la structure secondaire (les liaisons hydrogène entre les bases sont coupées, ...). La température correspondante à l'augmentation de la densité optique à 260 nm est la température de fusion (Tm) de l'ADN

Question 8: Connaissant la Tm du poly-dAT (63,3°C) et du poly-dGC (110°C), pouvez- Prédiction de la Tm du DNA L: environ 87,5°C

Question 9: La valeur Tm du DNA L représente au niveau structural la richesse en CG. Plus un ADN est riche en CG, plus sa Tm est élevée. En effet, il y'a 3 liaisons hydrogène en C et G et uniquement 2 liaisons hydrogène entre A et T.


Actions takween pour la promotion de la culture scientifique et la réussite de la transition Lycée-Université
تكوين. دعم الثقافة العلمية و مواكبة الانتقال من الثانوية إلى الجامعة

Afin de pouvoir continuer à servir les visiteurs, soutenez nos actions sur le site takween en faisant acquisition des ouvrages et supports pédagogiques desitinés à améliorer l'enseignement et la recherche scientfique en Biochimie.

Livres biochimie, sciences vie

CHAINE YOUTUBE, LIVRES

CHAINE YOUTUBE
Youtube chaine

Chaine Youtube (abonnement). Plusieurs vidéos multilingues
LIVRES + DVD
Ouvrages (livres) multilingues pour faciliter la transition Secondaire-Supérieur (Ar, Fr) avec DVD + QCMs, Exercices:>
-Glossaire trilingues Français-Arabe-Anglais
Glossaire
- Livre 'Sciences de la vie. Protéines et Enzymes' (+ DVD), Baaziz,2013
Protéines et Enzymes, Baaziz 2013

SEMESTRES / EVALUATION

demo-image

- Semestres S2
- Semestre S3
- Semestre S4


QCM, Examens, Contrôles
QCM, Examens