Biochimie. cours, techniques, qcm et applications en biotechnologies
Accueil --- Préambule --- Cellule --- Biochimie-Matériaux --- Protéines ---- Protéomique--- Enzymes, enzymologie --- Biologie-moléculaire & Génie-génétique --- Visualisation-moléculaire-JMOL-Rastop --- Biotechnologies-applications --- Techniques --- Takween supports --- Biochimie. Downloads Fr, Ar, Eng --- QCM-exercices-examens ---- Liens-utiles --- Etudiants-etudes --- Annonces --- Newsletter --- E-books --

Acides nucléiques (DNA, RNA). Contrôles (examens) S3

Les acides nucléiques sont représentés par l'ADN (DNA) et l'ARN (RNA). Ils sont constitués de nucléotides différents par les bases azotées pour le même type d'acides nucléiques et par les bases azotées et le pentose entre ADN et ARN


Avertissement: Une fois les examens et contrôles sont organisés par l'Institution d'origine, celle ci détient possession des archives qui deviennent disponibles sur les supports d'information (dont site web) de l'Institution et sont ainsi rendues accessibles pour aider les étudiants des années suivantes à préparer leurs contrôles et examens. Tout usage dans cette optique reste légal et n'enfreigne pas la loi.
Sur cette même page: Acides nucléiques, contrôle 2012 -- Acides nucléiques, contrôle 2008 --

Contrôle 1 du module 'Biochimie structurale, partie acides nucléiques, 2012, Filère 'sciences de la vie', Faculté des Sciences, Université Cadi Ayyad, Marrakech, Maroc, durée 30 minutes) ---- Réponses brèves


Un fragment de restriction 'X' est obtenu après hydrolyse complète d'un génome viral par endonucléase de restriction EcoRI. La taille de ce fragment a été estimée par électrophorèse à 210 paires de bases (pb). Dans le but de l'étudier, le fragment 'X' a été isolé et purifié du reste du génome viral. Par la suite, ce fragment a été soumis à son tour à deux types d'hydrolyse par une nouvelle endonucléase de restriction appelée BamHI:

- Une hydrolyse complète (les conditions sont telles que tous les sites de restriction BamHI sont coupés).

- Une hydrolyse partielle (les conditions sont telles que le nombre de sites coupés par BamHI varie entre zéro à plusieurs coupures par molécules).

lexique


Recherche rapide dans ce site et les sites liés de l'auteur (Fr, Ar, Eng) - بحث سريع في هذا الموقع و المواقع المرتبطة للمؤلف:


Glossaire des sciences de la vie, trilingue (Fr, Ar, Eng) + Préparations Examens et contrôles S1, S2, S3 + DVD introductinon MOOC:

Sciences de la vie. Glossaire


Sciences et vie, Biochimie

Protéines et Enzymes, Baaziz 2013


Le diagramme ci contre représente les résultats obtenus après analyse électrophorétique de:

- (a): L'ADN 'X' natif (non coupé par BamHI.
- (b): L'ADN 'X' après hydrolyse complète par BamHI.
- (c): L'ADN 'X' après hydrolyse partielle par BamHI.

Les chiffres de 30 à 210 indiquent la taille en pb correspondant aux différentes bandes observées.

Question 1:

Pour l'ADN 'X', représenter la carte de restriction en précisant l'emplacement des sites de coupures par EcoRI et BamHI.

électrophorèse fragments d'adn viral
Question 2:

D'après la carte établie, quelle est la caractéristique particulière de l'ADN 'X'? (c'est à dire: comment est-il organisé?)

Question 3:

Si les produits de l'hydrolyse complète par BamHI (fragments de 30 pb de longueur) sont analysés par la méthode de séquençage Sanger, combien de séquences primaires différentes peut-ton trouver? Justifier votre réponse.

Question 4:

L'analyse de la composition de l'ADN 'X' montre un rapport (A+T)/(G+C) = 2.

a) En déduire les pourcentages en A, T, C et G de cet ADN.
b) Quelle sera sa Tm, sachant que: Tm en °C = 69,3 + 0,41 % (G + C).
c) Représenter la courbe de dénaturation thermique de l'ADN 'X' en partant d'une solution d'ADN natif à 50 µg/ml. La courbe doit être correctement légendée.
d) Compte tenu de son organisation particulière, à quoi doit-on s'attendre si l'ADN 'X' est lentement renaturé?.


Réponses brèves -- Revenir au contrôle 2012
Avertissement: Les éléments d'information ci joints ne peuvent constituer les réponses complètes aux questions posées, considérant d'éventuels manques de précisions que le responsable de l'épreuve pourrait fournir suite à la demande des étudiants.

Question 1 .....

Question 2. L'ADN X est constitué d'une répétition d'un fragment de 30 pb comme le montre le profil électrophorétique de l'hdrolysat (hydrolyse totale).

Question 3. Une seule séquence de 30 pb qui se répète une fois, 2 fois, 3 fois, ... ou 7 fois) ....


Contrôle 1 du module 'Biochimie structurale, partie acides nucléiques, 2008, Filère 'sciences de la vie', Faculté des Sciences, Université Cadi Ayyad, Marrakech, Maroc, durée 60 minutes) ---- Réponses brèves


Un fragment de DNA X a été séquencé par la méthode de Sanger. Le résultat obtenu est représenté par la figure ci dessous. Le sens de la migration électrophorétique est signalé par la flèche orientée vers le bas

Question 1: Que représentent les bandes visibles sur l'autoradiogramme ?

Question 2: Où se situe la différence entre le ddATP et le dATP ?

Question 3: Dans la réaction contenant du ddATP, quels sont les points communs (identiques) entre les différents produits de la réaction ?

Question 4: Mise à part la complémentarité avec le brin matrice, quels sont les points communs entre l'ensemble des produits obtenus au niveau des quatre réactions ?

Question 5: Déduire à partir de cette figure la séquence nucléotidique du brin matrice correspondant au DNA X.

Question 6: Quel est le pourcentage en G + C du DNA X ?

Le DNA X analysé ci dessus, provient d'un organisme eucaryote. Il représente une seule unité de répétition en série formant un DNA nettement plus long: c'est le DNA L (ou 'Ladder'). Le DNA L est un DNA hautement répété où les unités de DNA X se retrouvent répétées plusieurs milliers de fois.

Acides nucléiques (DNA)

Le DNA L a été isolé par ultracentrifugation isopycnique. L'étude de la variation de l'absorbance à 260 nm est menée en fonction de la température (entre 20°C et 100°C). Cette étude fait apparaître une augmentation brutale de l'absorbance suivie d'une stabilisation.



Question 7: Que représente l'augmentation de l'absorbance ?. Cette augmentation révèle-t-elle une modification structurale du DNA ? Laquelle ?

Question 8: Connaissant la Tm du poly-dAT (63,3°C) et du poly-dGC (110°C), pouvez- vous prédire (déterminer) la Tm du DNA L ?. Justifier votre réponse.

Question 9: Que représente la valeur Tm du DNA L au niveau structural ?

Question 10: A partir des résultats obtenus, serait-il possible de déterminer la densité en g/cm3 du DNA L ?. Justifier votre réponse.

Question 11: Le DNA X et le DNA L sont dénaturés séparément et renaturés par chauffage puis refroidissement lent. Lequel des deux DNA reformera le plus souvent la molécule d'origine ?. Justifiez votre réponse.


Réponses brèves -- Revenir au contrôle 2008
Avertissement: Les éléments d'information ci joints ne peuvent constituer les réponses complètes aux questions posées, considérant d'éventuels manques de précisions que le responsable de l'épreuve pourrait fournir suite à la demande des étudiants.

Question 1: Les bandes visibles sur l'autoradiogramme représentent l'emplacement des fragments d'ADN complémentaires à l'ADN matrice et synthétisés par la DNA polymérase en présence de quatre désoxyribonucléotides (dATP, dCTP, dGTP, dTTP) auxquels sont ajoutés de faibles concentrations de l'un des quatre didésoxyribonucléotides (ddATP, ddCTP, ddGTP ou ddTTP). Le marquage radioactif (32P) porte sur le phosphore de l'amorce

Le principe du séquençage de l'ADN par la méthode de Sanger, consiste à initier la polymérisation de l’ADN à l'aide d'un petit oligonucléotide (amorce) complémentaire à une partie du fragment d’ADN à séquence (matrice)r. L’élongation de l’amorce est réalisée par le fragment de Klenow (une ADN polymérase I dépourvue d’activité exonucléase 5’->3’) ou une ADN polymérase thermostable utilisée pour la PCR. Les quatre désoxyribonucléotides (dATP, dCTP, dGTP, dTTP) sont ajoutés, ainsi qu’une faible concentration de l'un des quatre didésoxyribonucléotides (ddATP, ddCTP, ddGTP ou ddTTP)

Question 2: La différence entre le ddATP et le dATP se situe au niveau d'un manque de OH sur le carbone 3' du désoxyribose du ddATP ('faux nucléotide' non reconnu par la DNA polymérase, la polymérisation s'arrête dès qh'elle bute contre le didésoxyribonucléotide).

Question 3: Dans la réaction contenant du ddATP, les points communs (identiques) entre les différents produits de la réaction sont le port d'une extrémité à ddATP non reconnu par la DNA polymérase.

Question 4: Les points communs entre l'ensemble des produits obtenus au niveau des quatre réactions, mise à part la complémentarité avec le brin matrice, sont: 1/ la terminaison des fragments d'ADN synthétisé par l'un des quatre didésoxyribonucléotides (ddATP, ddCTP, ddGTP ou ddTTP), 2/ Tous les produitd sont prteurs de la radioactivité 32P.

Question 5: La séquence nucléotidique du brin matrice correspondant au DNA X est:

- Séquence néosynthétiséé: lecture du bas du gel (extrémité 5') vers le haut (extrémité 3'): 5'TAGCGATGCTTCAATGCTATCCGTCAGCC3'

- Séquence recherchée: 3'ATCGCTACGAAGTTACGATAGGCAGTCGG5'

soit: 5' GGCTGACGGATAGCATTGAAGCATCGCTA3'

Question 6: Pourcentage en G + C du DNA X: 51,7%

Question 7: L'augmentation de l'absorbance à 260 nm en présence du chaffage représente l'effet hyperchrome ou hyperchromicité et correspond à la dénaturation de l'ADN par altération de la structure secondaire (les liaisons hydrogène entre les bases sont coupées, ...). La température correspondante à l'augmentation de la densité optique à 260 nm est la température de fusion (Tm) de l'ADN

Question 8: Connaissant la Tm du poly-dAT (63,3°C) et du poly-dGC (110°C), pouvez- Prédiction de la Tm du DNA L: environ 87,5°C

Question 9: La valeur Tm du DNA L représente au niveau structural la richesse en CG. Plus un ADN est riche en CG, plus sa Tm est élevée. En effet, il y'a 3 liaisons hydrogène en C et G et uniquement 2 liaisons hydrogène entre A et T.



- -
Acides nucléiques (ADN, ARN), Examens